Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:197 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gagcggattgcttttcgggacATGCCCTCAAGCCATATCCGCCCTGAATTCCTGTTTTCACGCAATT
CCGGCGAAACACGGGTTCCCGTGTTTCTGGAATTTTTCCAAAGTGCACCTTGCGCCCT
TTTCGTCAAGTGGTAAatcgtttttaccacttctgcacgtgctaaacagtttctccgtccgtgcatcaatcgacttgcacagcctgct
gcccgcacgctagagcttagtctggccggagtgaaacaaagatcaacaggattatgcttcaagcggcaggagcaggatgatacgagcATG

    BRA0178


Gene: BRA0178     GI: 23499940     BI number: BRA0178     GOG: COG0583     Description: transcriptional regulator, LysR famil


  A
T  T
A  C
C  C
 CG
 GC
|  C
A  C
 AT
 CG
 TA
C  A
C  T
C  |
G  |
T  |       AT
A  |      A  T
c  |      C  C       TT
 aT        GC       G  C
 gC        CG        GC
 gC       A  G       GC
 gT       C  C       CG
 cG        TG        AT
|  T       TA        CG
|  T       TA        AT
|  T       TA        AT
t  T       GC        AT
t  C       TA        GC
t  A      C  C      C  |
t  C       CG       G  |
 cG        TG        GT
 gC        TG        CG
 tA        AT        CG
 tA        AT        TA
 aT        GC        TA
                        TTTTTCCAAAGTGCACCTTGCGCCCTTTTCGTCAAGTGGTAAatcgtttttaccacttctgcacgtgctaaacagtttctccgtccgtgcatcaatcgacttgcacagcctgctgcccgcacgctagagcttagtctggccggagtgaaacaaagatcaacaggattatgcttcaagcggcaggagcaggatgatacgagcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG0583 Transcriptional regulator ... can be seen here

    ..................................................................................................................