                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:206 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-11.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGAACCCGCGTGGTGGTCCGCTGAgggattcacaagcgcaaacagcggtttttatgggggtcgccttacgggaaggcgacc
cagttatttttcacaagtttgaaatatccgaatttcctgcaaggaaagaaccggcgagcggcaaagatgtgcgaaagggcttttccttttcgggcgaaca
cccatatgctgccattggcaaagtccgaagaatattcgtcaaagagctgccgcgagggataatgtggtggccagcgccccggaaaacggcgcaaaagata
agtgggaaaggatatatcATG

    BRA0183 Gene: BRA0183     GI: 23499945     BI number: BRA0183     GOG: COG0656     Description: oxidoreductase, aldo/keto reductase famil   a a  c a  a cg gc cg g  g at at |  t |  t |  t |  a |  t c  g        g a  g      c  g cg       a  g tg        ta tg        ta at        cg gc        cg |  g       gc gc        cg gc        ta At        gc Gt        gc Ta        gc             agttatttttcacaagtttgaaatatccgaatttcctgcaaggaaagaaccggcgagcggcaaagatgtgcgaaagggcttttccttttcgggcgaacacccatatgctgccattggcaaagtccgaagaatattcgtcaaagagctgccgcgagggataatgtggtggccagcgccccggaaaacggcgcaaaagataagtgggaaaggatatatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0656 Aldo/keto reductases, related to diketogulonate reductase ... can be seen here     ..................................................................................................................