                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-15.82 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G=-11.62 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAGCGGAACCAGCTTGCCAGCTTCGTCACGAGCGCCAGCACCGGCTGCAACGACTTC
GCCTTCCTGCGGCTTTTCCTTGGCAGTGTCAGGGATGATGATGCCGCCGGCAGTCTTG
GCTTCCGATTCGACGCGGCGAACGACGACGCGGTCATGAAGCGGGCGGAACTTGATAT
CAGCCATggtataacccttggtgttatagacgttgaaccctgttacgcggaccggaatggcccgctgttagcacgctattcgtccgagtgctaac
gtggttcttgagatagaagccgcatgtttttTTG

    BRA0197 Gene: BRA0197     GI: 23499958     BI number: BRA0197     GOG: -------     Description: hypothetical protei   a g  a g  t cg cg a  c gc gc cg gc |  t cg at |  t ta tg gc t  |        c c  |      t  g c  |      t  t c  |      a  c a  |      t  c a  |      c  g g  |      g  a t  |       cg t  |       at g  |       cg c  |       gc a  |       at        ag g  |       ta       g  a a  |       ta       t  t t  |       gc        ta a  |      t  |       cg t  |       cg       |  a ta        gt        ta gc        cg        tg tg        cg        gc gc       c  t       gc gt        gt        tg ta        gc        gc                         atgtttttTTG     ..................................................................................................................