                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCAAGGCCTGCTTCGTCATTCTTGATTTCATGGAAATGCGCGGCACGCGCGGTGCGC
TGCGCCCCGCGCTTCTCACCTGGCCGGCGATCCTGCTCACCCTTGCGCTTGCGCGTTC
TGTCGCAGTCAGCCTGCTGGGCTGAgccaactgcctgcatctttgcctattcgcaaagaagggttctgcgcgaccgatagaa
gggaagcatcccgcggggccggcgaggggaattgcccggccgcattttctgcgggggattggctgccggagcgatggttccggccaatgaaaggacgaag
ggATG

    norC --- norB Gene: norC     GI: 23500005     BI number: BRA0248     GOG: COG2010     Description: nitric-oxide reductase, small subunit Gene: norB     GI: 23500006     BI number: BRA0249     GOG: COG3256     Description: nitric-oxide reductase, large subuni at t  t c  c       ag cg       t  a gc       a  a ta       g  g ta        cg ta        cg cg       |  a       gg ta       |  a      g  a a  a      |  g      g  a c  |      |  c       at g  |      |  a       gt tg        at        cg cg        gc       |  c cg       c  c       gc gt        gc        gc t  t       cg        cg c  c       gc        cg a  |       tg        gc at        cg        gc cg        tg       g  | |  c       tg       g  | cg        gc        cg gc        gc        gc                         attttctgcgggggattggctgccggagcgatggttccggccaatgaaaggacgaagggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2010 Cytochrome c, mono- and diheme variants ... can be seen here [P] COG3256 Nitric oxide reductase large subunit ... can be seen here     ..................................................................................................................