                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:150 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-15.20 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGACCGTGAGGCAAGCGCCCATCTGCCCGCGCTTTTCGGGCGTGGCGGTTATGCGCTC
GTCGCCAATCTGGCGAAATTGCCGGTCGCACTGCCTGCGATCTATCGCATGTTGGCAG
GCTGAaacaacgtctggaacatgctctctttttcgggagatatgcttcaattctttgcatctcaaacttggtcttgtttgagatgcaacaaatcatc
catggctgtatcgatttagtatgtctttcatgatgatgcaggctgtcgtcatcatctatcgatattggacggccctggacgagcaagATG

    BRA0252 --- BRA0253 --- BRA0254 --- BRA0255 Gene: BRA0252     GI: 23500009     BI number: BRA0252     GOG: COG4309     Description: conserved hypothetical protein Gene: BRA0253     GI: 23500010     BI number: BRA0253     GOG: NOG09829     Description: conserved hypothetical protein Gene: BRA0254     GI: 23500011     BI number: BRA0254     GOG: NOG06377     Description: conserved hypothetical protein Gene: BRA0255     GI: 23500012     BI number: BRA0255     GOG: COG2151     Description: conserved hypothetical protei            CT           T  A            AT            GC         a            CG       a  c            GC       A  a            TA       G  a           |  T      T  c           |  G       Cg           |  T       Gt           |  T       Gc            CG        At   G        CG        Cg T  C       GC       G  g C  C       TA       G  | AT        CG        Ta CG       A  |       Ta GC        CG        Gc CG        GC        Ta TA       |  T       At GT        CG        Cg GC        TA        Gc                         tctctttttcgggagatatgcttcaattctttgcatctcaaacttggtcttgtttgagatgcaacaaatcatccatggctgtatcgatttagtatgtctttcatgatgatgcaggctgtcgtcatcatctatcgatattggacggccctggacgagcaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4309 Uncharacterized conserved protein ... can be seen here [R] COG2151 Predicted metal-sulfur cluster biosynthetic enzyme ... can be seen here     ..................................................................................................................