                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:141 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-14.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGACAACCACACGCGGCTGCCCTGCTGCCGGTTTTCTCACGCAGGCCGTTCAGGCCT
GCATCGAGGAGATCGAGGGGGTGACGGGCGCCAGGGTCGAACTGACCTATGAGCCGGA
ATGGAAGCCTGAAATGGCTATACCGGAAGTACAGGCGATTTTTGCGGCCCCTTCCTTC
TGAgaaaacgctcgcctgcgatgccgtgcgaggtgctgcgcgcatggctcgcggaaaatttgtttgtgagaatcagccaaagctgttttgctaaacgc
gaataaaccgttctccacgaaagtcggtATG

    BRA0256 --- BRA0257 --- BRA0258 Gene: BRA0256     GI: 23500013     BI number: BRA0256     GOG: -------     Description: conserved hypothetical protein Gene: BRA0257     GI: 23500014     BI number: BRA0257     GOG: COG2020     Description: conserved hypothetical protein Gene: BRA0258     GI: 23500015     BI number: BRA0258     GOG: COG3319     Description: hypothetical protei   A A  C G  T CG TA GC GC GT |  A AT CG C  A G  |                  A CG                 T  T GC                 C  A GC                  GC |  G                 GC |  G                 TG |  A                |  G |  A                |  A GT                 |  A CG                 A  G |  G       AA       A  T A  A      G  A      A  A G  A      T  T       GC TG        CG        TA GC        CG        CG GC        GC        CG GT        AT        GC                         GATTTTTGCGGCCCCTTCCTTCTGAgaaaacgctcgcctgcgatgccgtgcgaggtgctgcgcgcatggctcgcggaaaatttgtttgtgagaatcagccaaagctgttttgctaaacgcgaataaaccgttctccacgaaagtcggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG2020 Putative protein-S-isoprenylcysteine methyltransferase ... can be seen here [Q] COG3319 Thioesterase domains of type I polyketide synthases or non-ribosomal peptide synthetases ... can be seen here     ..................................................................................................................