Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:141 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-14.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGACAACCACACGCGGCTGCCCTGCTGCCGGTTTTCTCACGCAGGCCGTTCAGGCCT
GCATCGAGGAGATCGAGGGGGTGACGGGCGCCAGGGTCGAACTGACCTATGAGCCGGA
ATGGAAGCCTGAAATGGCTATACCGGAAGTACAGGCGATTTTTGCGGCCCCTTCCTTC
TGAgaaaacgctcgcctgcgatgccgtgcgaggtgctgcgcgcatggctcgcggaaaatttgtttgtgagaatcagccaaagctgttttgctaaacgc
gaataaaccgttctccacgaaagtcggtATG

    BRA0256 --- BRA0257 --- BRA0258


Gene: BRA0256     GI: 23500013     BI number: BRA0256     GOG: -------     Description: conserved hypothetical protein
Gene: BRA0257     GI: 23500014     BI number: BRA0257     GOG: COG2020     Description: conserved hypothetical protein
Gene: BRA0258     GI: 23500015     BI number: BRA0258     GOG: COG3319     Description: hypothetical protei


  A
A  C
G  T
 CG
 TA
 GC
 GC
 GT
|  A
 AT
 CG
C  A
G  |                  A
 CG                 T  T
 GC                 C  A
 GC                  GC
|  G                 GC
|  G                 TG
|  A                |  G
|  A                |  A
 GT                 |  A
 CG                 A  G
|  G       AA       A  T
A  A      G  A      A  A
G  A      T  T       GC
 TG        CG        TA
 GC        CG        CG
 GC        GC        CG
 GT        AT        GC
                        GATTTTTGCGGCCCCTTCCTTCTGAgaaaacgctcgcctgcgatgccgtgcgaggtgctgcgcgcatggctcgcggaaaatttgtttgtgagaatcagccaaagctgttttgctaaacgcgaataaaccgttctccacgaaagtcggtATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG2020 Putative protein-S-isoprenylcysteine methyltransferase ... can be seen here
[Q] COG3319 Thioesterase domains of type I polyketide synthases or non-ribosomal peptide synthetases ... can be seen here

    ..................................................................................................................