                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:81 nt.    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.80 kcal/mol
Antiterminator:    Distance from promoter:54 nt. Size=39 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaact-gaaaat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaacttatggttcggcatgaacgaaaatggttcagctttaggagtaaaaccgaagatgggggcaatccattggcaaggttttgcgacgccaagatgggg
cattttcgtcatatcgcgcagcgacgtggtgtatttttctgctgcacgcgtcgaaactccgttaaaggggaacaattccatgcggtcgtttcttccgttc
agccgaaaaataccctcacgccgaaccgtaacttaattcgtcaccacagcctaaacttgtaaggactgaaaaATG

    BRA0268 --- BRA0269 Gene: BRA0268     GI: 23500025     BI number: BRA0268     GOG: COG4221     Description: ribitol dehydrogenase Gene: BRA0269     GI: 23500026     BI number: BRA0269     GOG: COG1069     Description: ribitol kinas tt t  t a  c cg gt gc g  a gt ta at gc        gc a  |      a  g a  |      c  a c  |       gc cg        cg gc        gt cg        cg a  c       tg g  a       at cg        tg gc        at             atttttctgctgcacgcgtcgaaactccgttaaaggggaacaattccatgcggtcgtttcttccgttcagccgaaaaataccctcacgccgaaccgtaacttaattcgtcaccacagcctaaacttgtaaggactgaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4221 Short-chain alcohol dehydrogenase of unknown specificity ... can be seen here [C] COG1069 Ribulose kinase ... can be seen here     ..................................................................................................................