Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=65 nt.     Delta G= -5.83 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcagggcgggtgccgttgctttcacgggaactaaaatgtgaaagtctcaatttggtttcaacgataaatgcagttgactgcccaaattgggtcttttttt
cacaactgttgttttcgcgctcaggccactcttcgggaaagcgcaatatccacaccctataaatacagaagaattctccaggcaatattcgatcagcccc
gacagattaagcccaaaatgggcactgactttgtttaccgcacggaatttcttactgaggataagcgtcccggcgtgatattagcgcaataagctcggca
TTG

    BRA0337


Gene: BRA0337     GI: 23500092     BI number: BRA0337     GOG: -------     Description: hypothetical protei


  a
a  t
c  a
g  t
c  c
g  c
a  a
a  c
a  a
 gc
 gc
 gc
|  t
|  a
|  t
|  a
|  a
|  a
|  t
|  a
|  c
|  a
 cg        cc
 ta       g  c
 ta       a  c        a
 cg        cg       a  a
 ta        ta       a  t
|  a      a  c       cg
c  t      g  a       cg
a  t       cg        cg
c  c       ta        gc
c  t      t  t      a  a
 gc       a  t      a  |
 gc       t  a      t  |
a  a      a  a      t  |
c  |      a  |      a  |
 tg        cg        gc
 cg        gc        at
 gc        gc        cg
                        actttgtttaccgcacggaatttcttactgaggataagcgtcccggcgtgatattagcgcaataagctcggcaTTG


    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-10.22 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcagggcgggtgccgttgctttcacgggaactaaaatgtgaaagtctcaatttggtttcaacgataaatgcagttgactgcccaaattgggtcttttttt
cacaactgttgttttcgcgctcaggccactcttcgggaaagcgcaatatccacaccctataaatacagaagaattctccaggcaatattcgatcagcccc
gacagattaagcccaaaatgggcactgactttgtttaccgcacggaatttcttactgaggataagcgtcccggcgtgatattagcgcaataagctcggca
TTG

    BRA0337


Gene: BRA0337     GI: 23500092     BI number: BRA0337     GOG: -------     Description: hypothetical protei


 ct
a  a
a  a
g  a
g  a
 gt
 cg
 at
 cg                   a
 ta                 a  t
 ta                 a  t
 ta                  cg
 cg        aa        cg
 gt       a  t       cg
|  c      t  g       gt
|  t      a  c      |  c
|  c      g  a      |  t
|  a       cg       |  t
|  a       at       |  t
t  t       at       |  t
t  t       cg       |  t
 gt        ta       |  t
 cg       |  c      t  t
 cg       |  t      c  c
 gt       t  g      a  a
|  t      t  c       gc
|  t       gc        ta
t  c       gc        ta
g  a       ta        gc
g  a       ta        at
 gc        ta        cg
 cg        at        gt
                        tgttttcgcgctcaggccactcttcgggaaagcgcaatatccacaccctataaatacagaagaattctccaggcaatattcgatcagccccgacagattaagcccaaaatgggcactgactttgtttaccgcacggaatttcttactgaggataagcgtcccggcgtgatattagcgcaataagctcggcaTTG


    ..................................................................................................................