                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -4.41 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -7.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCTTTGCGCTTTCCACCGGCAAGGCGAAGGATGGGCAAGCTGATGTAACCGCAATC
GGGGCAATTGCCGCAAGCGTTATGGCCGACGCGGTGGCCCGCGCCGTCGTCCAGGCAG
AAAGCCTTCCCCATCTCAATCTGCCCGCCCACCGGGATTACATGATTGCGGAAAGCAC
TCGATAAccacgcgcccagccgacgattgaactggcctgcaatataagcgatataagaagctgaatttgcagtattttcaattttgcgaagcgta
atttccaggcagatacaggttcgatggcagcATG

    BRA0348 --- BRA0347 Gene: BRA0348     GI: 23500101     BI number: BRA0348     GOG: COG1109     Description: phosphoglucomutase, putative Gene: BRA0347     GI: 23500100     BI number: BRA0347     GOG: COG0662,COG0836     Description: mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomeras   A G  A G  A CG        tt GC       a  g TA       g  a T  C      c  a AT       a  c GC        gt TG        cg        ta A  A       cg       a  a C  |       gc       t  g AT       a  c      a  a TA       c  t      g  a TA       c  |       cg A  |       cg        gc Gc        gc        at Gc       |  a      a  g G  a      |  a      t  a C  c      |  t      a  a C  |      |  a      t  t A  |      |  t       at C  |      |  a       at C  |      |  a       cg Cg        cg        gc Gc        gc        ta Cg        cg        cg                         tattttcaattttgcgaagcgtaatttccaggcagatacaggttcgatggcagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1109 Phosphomannomutase ... can be seen here [G] COG0662 Mannose-6-phosphate isomerase ... can be seen here [M] COG0836 Mannose-1-phosphate guanylyltransferase ... can be seen here     ..................................................................................................................