                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGATGCAGCGCAGAAGCAGCGCCTGTTCTCCAATATCGCGGCTGCGATGAAGGGCGT
TCCAGGCTTTATCGTTGAGCGTCAGCTTGGCCATTTCAAGTTGATCCACCCGGAATAT
GAAGCCGGTGTGCGCAAGGCGCTCAAGGATGCCCATGGTTATGACGCCAACACAATTG
CCTTGAACGAAAAAATTACTGCAGCGGAATAGtatatatataatacagttatatttaatattggtcgccggttcat
ccggcgactactttttgtcttgaatttatatttaccgcctatactgtaagTTG

    BRA0356 --- BRA0357 Gene: BRA0356     GI: 23500109     BI number: BRA0356     GOG: -------     Description: hypothetical protein Gene: BRA0357     GI: 23500110     BI number: BRA0357     GOG: COG1495     Description: disulfide bond formation protein DsbB, putativ   A A  A G  A C  A A  A AT GT TA         c T  C      a  a C  T       tg CG        at GC        at TA        ta T  |       at A  |       ta A  |       at C  |      |  t A  |      t  t C  |      a  a        c A  |       ta       t  a A  |       at       t  t C  |       ta        gc CG        Gt        gc GC        At        cg CG        Tg        cg A  G      |  g       gc G  A      |  t       cg TA       A  c       ta AT       A  g       gc TA        Gc        gt TG        Gc        ta                         ctttttgtcttgaatttatatttaccgcctatactgtaagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1495 Disulfide bond formation protein DsbB ... can be seen here     ..................................................................................................................