Gene putatively regulated by attenuation in B_suis_1330_II
Characteristics of the secondary structures
Terminator: Distance from promoter:55 nt. Distance to gene:22 nt. Distance to run of Ts=0 nt. Size=22 nt. Delta G=-14.40 kcal/mol
Antiterminator: Distance from promoter:21 nt. Size=43 nt. Delta G= -5.67 kcal/mol
Anti-antiterminator: Distance from promoter:8 nt. Size=19 nt. Delta G= -7.70 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgaat-tttaat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgaatgttatatatggatttttttatttaattaataatagagtgggaaatcccgcgtccggcatcaaagagcattaaaacacccataagcccgcgtaac
tgcgggctttttcttggtatgggcatcttctcaccATG
BRA0380
Gene: BRA0380 GI: 23500133 BI number: BRA0380 GOG: ------- Description: hypothetical protei
ta
t a
a a
c a
g c
a a
g c
a c
a c
a a
c t
t a
a a aa
aa cg t c
a t gc gt
gc gc cg
gc c | gc
gc c | cg
tg t | cg
gc gc cg
| g cg gc
at gc at
gc cg at
tttcttggtatgggcatcttctcaccATG
..................................................................................................................