                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:34 nt.    Distance to gene:118 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-20.10 kcal/mol
Antiterminator:    Distance from promoter:29 nt. Size=19 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-gataat. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATTCAATTGAtggctggtcgataatagctggtttttgggcttagagcgcgttccggcatcgcacaaagctgcctcttcgggcagct
ttgtcgtttttcggcatcctttttcccatactcgaaatgcaagcgcagttaaaaccatcttgcaatcatttcggctatgtgaaactaattgacttgtagg
atatccattatcggtaaggttagctgaaATG

    BRA0402 --- BRA0403 Gene: BRA0402     GI: 23500154     BI number: BRA0402     GOG: COG0673     Description: oxidoreductase, putative Gene: BRA0403     GI: 23500155     BI number: BRA0403     GOG: COG0673     Description: oxidoreductase, Gfo/Idh/MocA famil tt t  t g  t g  g tg cg gc at |  t |  a t  g a  a a  g                 tt t  c                c  c a  g                 tg gc                  cg cg                  cg |  t                 gc t  t        a        ta gc       c  a       cg gc       a  a       gc tg        cg        at cg        gc        at g  |      c  |       at gc       t  |       cg ta        at        at At        cg       c  | Gc        gc        gc Tg        gc        cg                         tttttcggcatcctttttcccatactcgaaatgcaagcgcagttaaaaccatcttgcaatcatttcggctatgtgaaactaattgacttgtaggatatccattatcggtaaggttagctgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0673 Predicted dehydrogenases and related proteins ... can be seen here [R] COG0673 Predicted dehydrogenases and related proteins ... can be seen here     ..................................................................................................................