Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-15.97 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agctggcgtgatgatgtctatgcttttgatggcaaggactggaaggtggccggcaagctgccgcgcggtctggcctatggcgcagccttcgatgcgccgg
gcggtcttctggtcgtgggcggtgaagatagagacggcaaggcccgcaaggaggttttcctcctcaaatgggatggcaaggccctctcggtcgaaaactg
acttcgcagtggaaagagcgcttccatcgataccatttaaaccggaagcgttcttttttgaaagcttggcgacgatgcttctttgcgttattgttccaaa
ATG

    BRA0413


Gene: BRA0413     GI: 23500164     BI number: BRA0413     GOG: -------     Description: hypothetical protei


  a
a  g
 cg
 gc
 gc
t  c
 at
 gc
 gt        tt
 gc       c  c
t  |      a  g
a  |       gc
a  |       ta        ca
a  |       cg       c  t
c  |       at       a  t
t  |      a  g      t  t
 cg       a  |      a  a
 cg       a  |      g  a
t  t      g  |      c  a
c  c       cg       t  c
 cg        ta       a  c
 ta       g  a       cg
 ta       g  |       cg
 ta       c  |       ta
 ta        ta        ta
 gc        cg        cg
 gt        ta        gc
a  g       cg        cg
g  a      c  c       gt
 gc        cg        at
 at        gc        gc
 at        gt        at
                        tttttgaaagcttggcgacgatgcttctttgcgttattgttccaaaATG


    ..................................................................................................................