                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-20.50 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAATATTAAGCAGGGACAAACAATGACAGCCCGATGGTGAagttgcagaaggcgcacaaaaagacggag
atgaagaaattagagaaggcgcacaagaagcactaagcttctttactattccctccccgatccctgatagcctcttgcattctgggatcgatatccgggc
cactgcttcgctaatccctcaggattttccgaagcagtggtcttttcatgtgcttcatcactacacatacttgccggaaaatgattgacggccatattct
cttctgacgggcaaattcaggaagaggatcATG

    BRA0478 Gene: BRA0478     GI: 23500225     BI number: BRA0478     GOG: COG3189     Description: conserved hypothetical protei   c t  t c  t cg gc a  a t  t       cc        tc at       g  a      c  a gc        gc        cg t  t       gt        cg cg        cg        ta cg       c  c       at cg       t  t       at ta       a  |      |  t at       t  |      t  t gc        at       c  c cg        gc        gc |  a       cg        cg |  t      |  c       ta c  a      |  t       ta c  t      |  a       cg c  c       ta        gc t  c       at        ta cg        gc        cg cg        gc        at cg        gc        cg                         gtcttttcatgtgcttcatcactacacatacttgccggaaaatgattgacggccatattctcttctgacgggcaaattcaggaagaggatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3189 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................