                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:90 nt.    Distance to gene:96 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-13.20 kcal/mol
Antiterminator:    Distance from promoter:77 nt. Size=33 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:    Distance from promoter:46 nt.    Size=43 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaaa-tatatt. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaaatacatatatttataattatatattaataaattaatataagtgatgcaaatggatcatgatttgaaatattaggtttttcgtaaactttggattc
agtatttgccggtaagctttggttagcaatttgctcaggccgagcattgcagccctttgttttgcgtaacggtacccatgcgtttttcgctcgtgacagc
cattgcccttgctgccgccttgacaggctgcacgtcaagttcgggcatcgacaacatcATG

    BRA0487 Gene: BRA0487     GI: 23500234     BI number: BRA0487     GOG: COG3757     Description: glycosyl hydrolase, family 2 at g  t gc ta        gg         g tg       t  t      g  c t  t      t  t      a  c c  a       ta        cg at        cg        ta at        gc        cg at       |  a       gc tg       |  a       ta |  c      |  t      t  | gc        at       t  | cg        at        at tg        tg        at t  t       gc        cg ta        gt        gc ta       |  c      a  | tg       |  a       ta gc        cg        tg gt        cg        gc at        gc        gc                         ctttgttttgcgtaacggtacccatgcgtttttcgctcgtgacagccattgcccttgctgccgccttgacaggctgcacgtcaagttcgggcatcgacaacatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3757 Lyzozyme M1 (1,4-beta-N-acetylmuramidase) ... can be seen here     ..................................................................................................................