                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:63 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-15.50 kcal/mol
Antiterminator:    Distance from promoter:43 nt. Size=29 nt.     Delta G= -3.13 kcal/mol
Anti-antiterminator:    Distance from promoter:2 nt.    Size=48 nt.     Delta G=-18.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatc-tataat. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatcggctcacaccacatgggaatataattagagcgcatcccgaaaagtgtgaaacgattttcggaaaagatgcgcgtcaaaacaaaggattagagcg
ggctgcggcccgctttttatttttttccaaattcggaagcaataagctgcgcgaatcgaATG

    BRA0539 Gene: BRA0539     GI: 23500286     BI number: BRA0539     GOG: -------     Description: hypothetical protei   a g  a t  a gc tg g  a at at at at gc cg cg         a |  a      a  g |  a      a  g |  a      c  a |  a      a  t       gc cg       a  t      t  g ta       a  a       cg at       a  g       gc cg       c  a       gc gc        tg        gc cg        gc        cg gc        cg        gc |  g      g  g       at at        cg        gt gc        gc        at                         ttatttttttccaaattcggaagcaataagctgcgcgaatcgaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_II                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:65 nt.    Distance to gene:41 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-13.60 kcal/mol Antiterminator:    Distance from promoter:26 nt. Size=29 nt.     Delta G= -3.13 kcal/mol Anti-antiterminator:   Size=60 nt.     Delta G=-18.39 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgatc-tataat. It has a score value of 61.58 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgatcggctcacaccacatgggaatataattagagcgcatcccgaaaagtgtgaaacgattttcggaaaagatgcgcgtcaaaacaaaggattagagcg ggctgcggcccgctttttatttttttccaaattcggaagcaataagctgcgcgaatcgaATG     BRA0539 Gene: BRA0539     GI: 23500286     BI number: BRA0539     GOG: -------     Description: hypothetical protei ta t  g a  a a  g t  c a  g t  c a  a at gc gc gc tg a  a c  a a  a        g c  a      a  a cg       a  t at       a  g cg       a  c at       g  g cg       g  c       gc ta       c  g      t  g c  a      t  t       cg g  a       tc        gc gc        ta        gc cg        ta        gc ta       a  a       cg at        ga        gc gt        cc        at                         ttttatttttttccaaattcggaagcaataagctgcgcgaatcgaATG     ..................................................................................................................