                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gttttcaacttaattttcatatttatttcaagtgtttaacgttctttttttgggggcagaatgcgtaagtttgttaagagaaccgcaatttgtggatcgc
tcttattgatagcgatttttatgatgaatagttggagcggtattcagagcgggcataacgcatttcgtccagtctcaaaatcaaaaccagcatcaagtga
gacttgtaaagagtataacgaaaagggttttatcggaaaattgtttgatttttctgcacgtggttggtgcgattgattaaagaggcttcggcctcttttt
TTG

    BRA0560 Gene: BRA0560     GI: 23500304     BI number: BRA0560     GOG: -------     Description: hypothetical protei at         g a  t      g  t a  g      t  t at       g  g gt        cg gt        at cg        cg ta        gc at       t  | t  t       cg t  t       ta t  |      t  t t  |      t  t gt        tg gt        ta        tc gc        at       t  g at        gt        cg a  g       ta        gc a  c       ta        gc a  a       ta        at gc       g  g       gc cg        ta        at at        tg        at                         tttTTG     ..................................................................................................................