Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-19.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-19.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAGCTTTTCGACGAACTTCTGGCCGATGAAGAAGGCCATATCGACTTCCTTGAAAC
CCAGCTCGACCTTCTCGCCAAGATCGGCGAAGAACGCTATGGCCAGCTTAACGCGGCG
CCCGCCGACGAAGCTGAGTAAgcctgtttcaatctgtcttgaaagccggggcgcatcgctccggctttttctttggcagcatttt
caaaccgctgcgacaccgcaaaagcgccatccaatctttacctccgcccccttgttgtgataaggcgcgcgcaattttcccaattcgtaaggtattacaA
TG

    BRA0566


Gene: BRA0566     GI: 23500310     BI number: BRA0566     GOG: COG0621     Description: conserved hypothetical protein TIGR0112


 CC
G  C
 CG        tg
 GC       c  t
 GC       t  c
 CG        at
G  A       at
C  C       cg
A  G       ta
A  |       ta
 TA        ta
 TA       |  g        a
 CG       |  c      c  t
 GC       |  c       gc
 AT       g  g       cg
 CG        tg        gc
|  A       cg        gt
 CG        cg        gc
 GT        gc        gc
G  A      A  g       cg
T  |      A  c       cg
A  |      T  a       gc
 TA       G  |       at
 Cg        At        at
 Gc        Gc        at
                        ttctttggcagcattttcaaaccgctgcgacaccgcaaaagcgccatccaatctttacctccgcccccttgttgtgataaggcgcgcgcaattttcccaattcgtaaggtattacaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0621 2-methylthioadenine synthetase ... can be seen here

    ..................................................................................................................