                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-15.00 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACGCGCCCGACATTGTTCAATTATATTGCCAGGCGGGCCGATCTGGAAAAGACGAC
TGCTGAGCTTTTCGATGTCGTGGAAAGCGGGGCGGTCAAGATCGAGATCAACCAGACC
TATGCTCTCAAGGACGCCTGCAAGGCCCATGAAGCATTGGAGGCACGCAAGACGACAG
GCACGAGCATCCTGTTGCCATAGgtggggacgatagcggcggtgcatatgtccatcgctgctttcttttgggcttttcaagag
cgggcttgctggataaagtcgctcaaaaatactttggggaacaATG

    BRA0570 --- BRA0569 --- BRA0568 Gene: BRA0570     GI: 23500314     BI number: BRA0570     GOG: COG3845     Description: ABC transporter, ATP-binding protein Gene: BRA0569     GI: 23500313     BI number: BRA0569     GOG: COG4603     Description: ABC transporter, permease protein Gene: BRA0568     GI: 23500312     BI number: BRA0568     GOG: COG1079     Description: ABC transporter, permease protei            Gg   A       A  t G  G      T  g C  C      A  g A  A       Cg C  T       Cg GC       |  a GC        Gc AT        Tg CG        Ta AT        Gt        at G  |       Ta       t  g C  |       Cg       a  t A  |      C  c      c  c G  |      T  g       gc A  |      A  |       ta A  |       Cg        gt C  |       Gc        gc G  |      A  g       cg C  |      G  |       gc AT        Cg        gt CG        At        cg GC        Cg        gc GC        Gc        at                         ttcttttgggcttttcaagagcgggcttgctggataaagtcgctcaaaaatactttggggaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3845 ABC-type uncharacterized transport systems, ATPase components ... can be seen here [R] COG4603 ABC-type uncharacterized transport system, permease component ... can be seen here [R] COG1079 Uncharacterized ABC-type transport system, permease component ... can be seen here     ..................................................................................................................