                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:13 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G=-17.10 kcal/mol
Antiterminator: Size=51 nt.     Delta G= -8.59 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATTTCCGATTTCCGACTGGATCAAGGGTGATGGCGCGGATTGCTGCAAGCTGATCGG
CGATATTCCGGGCACGCAGACCGATACCGCAGTTGCTTTGCGTCTGGGCGATGATGAT
CTGCGCGAACAGTTCAATGCGGCGATAAAGAAAATCCGCGAAGACGGCACCTATGCCA
CAATCGTGAAGAAATATTTCGATTTCGATATCTATTGAtcgcttgtaaaactatcaactctttgctgaaaac
agcaacgcgccggtcttcttcggcgcgtttatttctttgttctaggaattggaaATG

    BRA0630 --- BRA0629 Gene: BRA0630     GI: 23500374     BI number: BRA0630     GOG: COG0665     Description: amino acid dehydrogenase, putative Gene: BRA0629     GI: 23500373     BI number: BRA0629     GOG: -------     Description: hypothetical protei            aa           a  a            gc            ta            cg            gc            ta           t  | TT       t  | A  T      c  | GC       t  | CG       c  | TA       a  | |  T      a  | |  A      c  | T  T      t  | T  C      a  | AT       t  | TA       c  | AT       a  | AT       a  | A  G      a  |       tt G  A      a  |      c  c A  |       ta       t  t At        gc        gt Gc        tg        gc Tg       t  c       cg Gc        cg        cg C  |       gc        gc T  |      |  c       cg At        cg        gc At        tg        cg Cg        At        at At        Gc        at                         tatttctttgttctaggaattggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_II                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-16.20 kcal/mol Antiterminator: Size=51 nt.     Delta G= -8.59 kcal/mol Anti-antiterminator:   Size=47 nt.     Delta G= -6.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AATTTCCGATTTCCGACTGGATCAAGGGTGATGGCGCGGATTGCTGCAAGCTGATCGG CGATATTCCGGGCACGCAGACCGATACCGCAGTTGCTTTGCGTCTGGGCGATGATGAT CTGCGCGAACAGTTCAATGCGGCGATAAAGAAAATCCGCGAAGACGGCACCTATGCCA CAATCGTGAAGAAATATTTCGATTTCGATATCTATTGAtcgcttgtaaaactatcaactctttgctgaaaac agcaacgcgccggtcttcttcggcgcgtttatttctttgttctaggaattggaaATG     BRA0630 --- BRA0629 Gene: BRA0630     GI: 23500374     BI number: BRA0630     GOG: COG0665     Description: amino acid dehydrogenase, putative Gene: BRA0629     GI: 23500373     BI number: BRA0629     GOG: -------     Description: hypothetical protei            ca           a  g            ac            aa            aa            gc            tg           c  | TT       g  | A  T      t  | GC       t  | CG       t  | TA       c  | |  T      t  | |  A      c  | T  T      a  | T  C      a  | AT       c  | TA       t  | AT       a  | AT       t  | A  G      c  | G  A      a  |       tt A  |       ac       c  c At        ag       t  t Gc        ac        gt Tg       t  c       gc Gc        gg        cg C  |       tg        cg T  |      |  t       gc At        tc        cg At        ct        gc Cg        gt        cg At        c        at                         ttatttctttgttctaggaattggaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here     ..................................................................................................................