                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-18.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCAAGCCGCTGATCTTCCGCGTTGCGGGCCGCTCCACGCATAATATTGATGAAATG
GTCCGCGTTGGTGCATCCGCCACGGATGTACATATTTTCGGCGCGGACGGACGCCGCG
TGAGCGACTGAttcatgccaaaacccgataagcctcactcatcgggttttggttaagcccatgcgccgatctgattctttcagatcaaaatg
cgcttcaggcagacggttgcgctgcaaacaagggcgcaaccgttgtttcctgttccgcggcaggtacgtgcacagtccgcataggggcttgcATG

    BRA0659 Gene: BRA0659     GI: 23500403     BI number: BRA0659     GOG: COG0471     Description: transporter, TrkA famil   c t  t t  t at gc ta cg ta at gc |  a |  a |  a |  a c  t cg gc                   a cg                 a  c gc                 a  a |  t                c  a t  t                g  g a  c                 tg c  a       tt        cg cg       g  g       gc cg        gc        cg gc        cg        gc a  a      a  |       ta a  |       gc        ta tg        at        gc ta        cg        gc gc        gc        cg                         ttgtttcctgttccgcggcaggtacgtgcacagtccgcataggggcttgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0471 Di- and tricarboxylate transporters ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_II                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:205 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G=-11.30 kcal/mol Antiterminator: Size=40 nt.     Delta G=-10.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGGCAAGCCGCTGATCTTCCGCGTTGCGGGCCGCTCCACGCATAATATTGATGAAATG GTCCGCGTTGGTGCATCCGCCACGGATGTACATATTTTCGGCGCGGACGGACGCCGCG TGAGCGACTGAttcatgccaaaacccgataagcctcactcatcgggttttggttaagcccatgcgccgatctgattctttcagatcaaaatg cgcttcaggcagacggttgcgctgcaaacaagggcgcaaccgttgtttcctgttccgcggcaggtacgtgcacagtccgcataggggcttgcATG     BRA0659 Gene: BRA0659     GI: 23500403     BI number: BRA0659     GOG: COG0471     Description: transporter, TrkA famil   T A  G G  A TA TA AT TG A  G A  T T  C A  C        C CG       C  A GC        GC CG        CG |  T       CG AT        TA CG        AT CG        CG T  T       GT CG        TA GC        GC             ATATTTTCGGCGCGGACGGACGCCGCGTGAGCGACTGAttcatgccaaaacccgataagcctcactcatcgggttttggttaagcccatgcgccgatctgattctttcagatcaaaatgcgcttcaggcagacggttgcgctgcaaacaagggcgcaaccgttgtttcctgttccgcggcaggtacgtgcacagtccgcataggggcttgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0471 Di- and tricarboxylate transporters ... can be seen here     ..................................................................................................................