Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G= -9.52 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggatcggccactatgcagtgggcattctctacggtgtgatctttgcgcttttgtgatctttgcgctttatggcggcgcggcatggtttgcgaacccaat
cttccttcccgcatggatatttggcatattgaccattgcggctggctggttcctgctgcaaccgggccttggaattggctgggcagcctcgaaattaccg
aatgcgggaaatgtgcgtattctcaatctcattgcgcacacatttttttcgctcggcatgtacggaacggcactgattcttttaaatacagtatagtcaa
ATG

    BRA0662


Gene: BRA0662     GI: 23500406     BI number: BRA0662     GOG: -------     Description: hypothetical protei


            a
          a  t
          c  c
  a       t  t
a  t      c  c
a  g      t  a
g  t      t  t
g  g       at
 gc        tg
 cg        gc
 gt        cg
 ta        gc
 at        ta
 at        gc
 gc        ta
            catttttttcgctcggcatgtacggaacggcactgattcttttaaatacagtatagtcaaATG


    ..................................................................................................................