Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-19.50 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -7.49 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTGCGCAAGGGCGACGACGAGCTGGTCGCCGCCATCAACAAGGCGCTCGATGAAATC
AAGGCCGATGGAACCTACAACAAGATCTCGCAAAAATATTTCGGCCAGGACGTTTCCA
AGTAAtattctgcctgcccgcaatcggcgaagccggatcagatccggcttcgttttgttgactgcggcaaatattcccaggacagaattgccagacc
gtataacatgaccgaatgcacttcttgctgtgcatgttcattccggcccgatttattatcccaattactgccaaggagccgaaactaGTG

    BRA0683 --- BRA0684


Gene: BRA0683     GI: 23500425     BI number: BRA0683     GOG: COG0765     Description: amino acid ABC transporter, permease protein
Gene: BRA0684     GI: 23500426     BI number: BRA0684     GOG: COG1126     Description: amino acid ABC transporter, ATP-binding protei


 GT
A  A
A  A
C  t
C  a        t
T  t      a  c
T  t      a  g
T  c       cg
 Gt        gc
 Cg        cg         a
A  |      |  a      c  g
 Gc       c  a       ta
 Gc        cg        at
 At        gc        gc
 Cg       t  c       gc
C  c       cg        cg
 Gc        cg        cg
 Gc       |  a       gc
 Cg       |  t       at
T  c       gc        at
 Ta        ta        gc
 Ta        cg        cg
 At        ta        gt
                        tttgttgactgcggcaaatattcccaggacagaattgccagaccgtataacatgaccgaatgcacttcttgctgtgcatgttcattccggcccgatttattatcccaattactgccaaggagccgaaactaGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here
[E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here

    ..................................................................................................................