                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-18.52 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGAAGGCCATTGCCGATGTCAAGGAAGCAAACAGCAAGGGCACTCTGCTTGGCTCC
ATGGCGCATGGCTATGCCAATCCGGCTGCCGTGAAGAATGCGATCTACGACGTCGTGA
CCCGCCAGTTCAACGGCCAGCTTTCTTCGGAAGATGCCGTCAAGGAACTCGTTGCGGC
GGTTGAAGCCGCAAAATAAggccacgcggaaacgtccgggggaacctcccggacgtttttcctgcgtgctccagcagaagcgcata
ggcggttggcgcagctaaccggcacttacgacggaattgcATG

    BRA0692 --- BRA0691 Gene: BRA0692     GI: 23500433     BI number: BRA0692     GOG: COG1175     Description: sugar ABC transporter, permease protein, putative Gene: BRA0691     GI: 23500432     BI number: BRA0691     GOG: COG0395     Description: sugar ABC transporter, permease protein, putativ   T T  G G  A G  A CG GC GC CG GC TA TA |  A G  A C  T T  A C  A                  a A  g                a  c A  g       aa        gc Gc       g  a       gt Gc        gc        gc A  a       cg        gc A  c       gt        gc C  |      |  c       cg Tg       c  c       cg Gc       a  g       ta Cg        cg        gc Cg        cg        cg                         tttttcctgcgtgctccagcagaagcgcataggcggttggcgcagctaaccggcacttacgacggaattgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here     ..................................................................................................................