                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.60 kcal/mol
Antiterminator:    Distance from promoter:76 nt. Size=42 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atggca-tacgat. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atggcaatcggcgcttcttccggtacgatacggctgctttcctgaaaacccgacatccgatgcgcaaggtggtgcacatcccggctgatcttctggtttg
tcattgtgttcgctcgctgcccggcctgattgtcaatcgagtttcatgtggcatgaatttcggttttatgtaagctgcagcaagcgtgaggcccaagagt
aacgaggacgaaaATG

   ق Gene: BRA0697     GI: 23500437     BI number: BRA0697     GOG: COG3453     Description: conserved hypothetical protei ga t  t c  t cg gt gc c  a c  a c  t g  |        g t  |      t  g c  |       gc gc        ta cg        at ta        cg cg        ta gt        ta c  t      t  t t  t       gt t  |       at gc        gc ta        cg gt        tg             ttttatgtaagctgcagcaagcgtgaggcccaagagtaacgaggacgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3453 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................