                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCGCTGGTCGATGGCCTCGGCGTTCGTTCGCCCGATGGTGTTGCCTATCGCTACAC
CTTCGTTGTGGACCCGGACAATGTGATCCAGCACGTCTATGCAACCAATCTCAATGTC
GGCCGTGCACCGAAGGACACGCTGCGTGTTCTCGACGCCCTCCAGACCGACGAGCTTT
GCCCGTGCAACCGCGAAGTCGGTGGTGAGACGCTCAAGGCAGCCTGAtcggctatgacaatggcg
tgtgaggcgggttcaggcccgcctttcttttatcctgtttcaaagacataatgagggttccATG

    ahpD Gene: ahpD     GI: 23500447     BI number: BRA0707     GOG: COG2128     Description: alkyl hydroperoxide reductase ac g  a ta at tg cg gc g  g c  t tg At        ca G  g      t  g Ta        tg Cg        gc Cg        gc Gc        gc |  g       cg A  g       gc Cg        gc Gt        at Gt        gt             tcttttatcctgtttcaaagacataatgagggttccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2128 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................