                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:179 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-11.60 kcal/mol
Anti-antiterminator:   Size=72 nt.     Delta G=-27.31 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaggaagtctcgacctccatcaacaccacggcagcaggcggcaacgccagcctgatggcgatcggctgatttcttcgcatatgtgaggcagaaaaggc
ggctttccggccgccttttctttgcgccacgcaaggcttgcatggctgtgcagaaaaatcgacaacagaacgaTTAGATTATTTTCTGA
AAAATCGGAATAAAATTTACAACGTGATTGACAGCCCGATTTAAAAGGCGAAGACTAT
ATATGCGCTGGCAAAGCGTCGGCGTGGAGGCGCCGTATAGAGGGAGGAAAATAATG

    BRA0720 Gene: BRA0720     GI: 23500458     BI number: BRA0720     GOG: COG1840     Description: ABC transporter, periplasmic substrate-binding protei ca g  a gc cg gc gc a  a c  | g  | a  | cg gc gc c  | a  | c  | c  | a  | c  | a  | at cg ta        ta at       a  t cg        cg cg        gt t  c       cg c  g       ta c  a       tg at        cg gc       |  c cg        ta        tc tg        tg       t  c |  c       ta        tg |  t      a  a       cg cg       g  a       gc ta        ta        gc gt        cg        cg at       g  g       gc at        gc        gc gc        cg        at gt        tg        at                         ttctttgcgccacgcaaggcttgcatggctgtgcagaaaaatcgacaacagaacgaTTAGATTATTTTCTGAAAAATCGGAATAAAATTTACAACGTGATTGACAGCCCGATTTAAAAGGCGAAGACTATATATGCGCTGGCAAAGCGTCGGCGTGGAGGCGCCGTATAGAGGGAGGAAAATAATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1840 ABC-type Fe3+ transport system, periplasmic component ... can be seen here     ..................................................................................................................