                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:89 nt.    Distance to gene:75 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-30.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAC-TAAAGT. It has a score value of 66.93 and is shown in blue

TTGAACTTACAAAAAACGACGCGCTAAAGTTGCTCAATGCAGCATTGGAAGGTAGATA
Aatcgctggccagacggtaatcaggtcaggcgtcgcgccaccatgggtgggggcgatgcatgagggggcaggttcttggggaggagcctgccccctttca
ttctttccttcttcgcgccaatgcccggaacaaatcgatatttcaagcgtttgacctggagtttgaatagggagagttgaacATG

    BRA0735 Gene: BRA0735     GI: 23500472     BI number: BRA0735     GOG: NOG08130     Description: immunoreactive 14 kDa protein BA14           gg          g  g           ta           tg           cg           ta           tg           gc           gc           at           cg           gc           gc           gc           gc           gc           at           gt             tcattctttccttcttcgcgccaatgcccggaacaaatcgatatttcaagcgtttgacctggagtttgaatagggagagttgaacATG     ..................................................................................................................