Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-12.20 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAATCATTGGCGGCGCAATCAGCCAGCCGCGCCCGGTTTACCGAGCACCCGCAGGTT
CACCCCATGTGCAATGGTGCTATAGCCGCTATAAGTCCTATCGGGCATCAGACAATAC
ATTCCAGCCCTATAACGGGCCACGCAAGCAGTGCCGTTCGCCTTATTCTCGTTAAttac
agcataaaccagaaaagcgcccatggaggcgctttctttttctattctggtggtctgattccgacatttgcatccctctgttcaagcgttgagcaaatgt
ttggaatcataccactagcaagcatATG

    BRA0736


Gene: BRA0736     GI: 23500473     BI number: BRA0736     GOG: -------     Description: hypothetical protei


            A
          A  t
          T  t
           Ta
 TG        Gc
G  C      C  |
A  C       Ta
 CG        Cg
 GT       T  c
 AT        Ta
A  C       At
 CG        Ta
 GC        Ta        tg
|  C      |  a      a  g
|  T      C  c      c  a
C  T      C  c       cg
A  A      G  a       cg
C  T       Cg        gc
C  T       Ta        cg
 GC        Ta        gc
 GT       G  a      a  |
 GC       C  a       at
 CG        Cg        at
 AT        Gc        at
 AT        Tg        gc
 TA        Gc        at
                        ttttctattctggtggtctgattccgacatttgcatccctctgttcaagcgttgagcaaatgtttggaatcataccactagcaagcatATG


    ..................................................................................................................