                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:13 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.52 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACCGTTTTGTACGGCCCCAAAATTTGCTGCGTAACCTTTCAAAAAATAATTCAAGGG
GACGGGGAGCAGCGTGGTGAACCTGGATGAattctcggctgtgggtggacatgtcgcgaaatgacctatatagaatca
ggcaacctttcaataatcattctgtgcggacctcctgcggtaagcaaattgtgcatgggcgttttgcacgggaatgaagtcttatcaatgtaaaaaagga
gcttaagtccgccagcacagcggggttaaatttattgcatggtattttatacgaggataaaagtATG

    BRA0740 Gene: BRA0740     GI: 23500477     BI number: BRA0740     GOG: COG4175     Description: glycine betaine/L-proline ABC transporter, ATP-binding protei tg a  g cg gc tg g  t t  | t  | at at at         g cg       t  t gc       a  a a  a      a  a a  |      c  a t  |      t  a g  |      a  a g  |       ta c  |       tg gc        cg tg        ta cg       |  g        c cg        gc       g  a ta        at       a  c |  a       at       c  a |  t      g  a       cg |  g      t  a       gc |  a      a  g       cg c  a      a  |       cg cg        gt        tg at        gc       g  g gc        gc        at gt        cg        at                         aaatttattgcatggtattttatacgaggataaaagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG4175 ABC-type proline/glycine betaine transport system, ATPase component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_II                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:29 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -8.70 kcal/mol Antiterminator: Size=43 nt.     Delta G= -5.52 kcal/mol Anti-antiterminator:   Size=23 nt.     Delta G= -5.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AACCGTTTTGTACGGCCCCAAAATTTGCTGCGTAACCTTTCAAAAAATAATTCAAGGG GACGGGGAGCAGCGTGGTGAACCTGGATGAattctcggctgtgggtggacatgtcgcgaaatgacctatatagaatca ggcaacctttcaataatcattctgtgcggacctcctgcggtaagcaaattgtgcatgggcgttttgcacgggaatgaagtcttatcaatgtaaaaaagga gcttaagtccgccagcacagcggggttaaatttattgcatggtattttatacgaggataaaagtATG     BRA0740 Gene: BRA0740     GI: 23500477     BI number: BRA0740     GOG: COG4175     Description: glycine betaine/L-proline ABC transporter, ATP-binding protei             a           a  t           c  g           t  t           a  a           t  a           t  a            ca            ta            ga         c            ag       g  a   c       |  g      a  c g  g       aa       c  a g  t       gg        cg g  t       tc        gc t  t      a  t       cg at       a  t       cg cg       g  a       tg gc       g  |      g  g ta        ga        at gc        cg        at tg        at        ta tg        cc        ta                         atttattgcatggtattttatacgaggataaaagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG4175 ABC-type proline/glycine betaine transport system, ATPase component ... can be seen here     ..................................................................................................................