                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:103 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAAAAAAGTTCGATGGCACCATTGCGCGCAAGGACGGAACGCAAGATCGTCTCAATT
GGCAAACGCTTTATTTCTGCCGCCGCGATGGCAATTTCTGGAAGATTACCGGCTTCGT
CGGCTATATGGCATATCGCTGAaagagcgccgttcggatggttttaaaatggcgttggcctgccggtcagcgccatttttgttc
atgccggatcgtaagtttattcgtcgatgcggcgcagtataatcacactatttttctcaaattatacatatttcctcttgagtgaacaatcaatctcctg
ATG

    BRA0741 Gene: BRA0741     GI: 23500478     BI number: BRA0741     GOG: -------     Description: hypothetical protei   g g  t t  t at gt g  a c  a ta ta gt        gc cg       t  c cg        cg gc        cg cg        gt gt        gc at        ta g  |       tg a  |       gc a  |       cg A  |       gc G  |       gc Tg        ta Cg        at Gc        at             tttgttcatgccggatcgtaagtttattcgtcgatgcggcgcagtataatcacactatttttctcaaattatacatatttcctcttgagtgaacaatcaatctcctgATG     ..................................................................................................................