                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-21.92 kcal/mol
Antiterminator: Size=57 nt.     Delta G=-23.20 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-16.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGGTCAACAAGGAAGAGGCGAAGATGGATTATTATGTCAATAATGCCGATCTTGCCG
CCTTTACCGCTCTTCTGCCGGATGCGCGTTTTGCTCCCGTCATTCCGGGCTGGGAAGA
AATTGCCGACATCACCTCCAATGCCATGCAGAGCATCTATCTCGGCAAGGGCGAACCG
GATGCCGTCCTGAAAGATGCCGCTGCCAAGGCAGACGCCATCTTGAAGAAATAGcttctc
ccccgcctgcccggcagctttgcccccacctgctgccgggccttttttccgggacaatgacagccaATG

    BRA0749 --- BRA0750 --- BRA0751 --- BRA0752 Gene: BRA0749     GI: 23500486     BI number: BRA0749     GOG: COG1175     Description: sugar ABC transporter, permease protein, putative Gene: BRA0750     GI: 23500487     BI number: BRA0750     GOG: COG0395     Description: sugar ABC transporter, permease protein, putative Gene: BRA0751     GI: 23500488     BI number: BRA0751     GOG: COG0251     Description: endoribonuclease L-PSP, putative Gene: BRA0752     GI: 23500489     BI number: BRA0752     GOG: COG5476     Description: conserved hypothetical protei            AT           A  A           A  G            Gc            At            At            Gc           T  t           T  c           C  c AA       T  c C  G      A  c CG       C  | GC       C  |        c TA        Gc       c  c CG        Cg       c  c |  A      A  c      g  a GC        Gc       t  c CG        At       t  c C  C       Cg       t  t GC        Gc        cg TA        Gc        gc AT       A  c       at GC       A  |       cg AT        Cg        gc AT        Cg        gc A  G       Gc        cg G  A       Ta        cg TA        Cg        cg CG        Gc        gc                         cttttttccgggacaatgacagccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here [J] COG0251 Putative translation initiation inhibitor, yjgF family ... can be seen here [S] COG5476 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................