                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:197 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cagatgatgcagcatcctgcatcacgtcgtttgcgcacatatgcccataagcgtcatggggccgtatgacaatcgttcaaagcgcgacaattgcgctatt
ttttaagtttgcccccgtttgggcactacctgcggctgcaacaattttacaaccggtgggcgttgaaacgcgttgccgtagacaaaaaggcactgctcca
tccataaaaagtcatggaattaccgcttgaacatgctctataccccttttcaaacaatgatgggtttcaactccagcgatccaaaggcggaacgatcaac
ATG

    proC Gene: proC     GI: 23500517     BI number: BRA0782     GOG: COG0345     Description: pyrroline-5-carboxylate reductas            ga           t  c           a  a            ta at        gt c  g      c  c t  g       cg g  g       gt cg        gt gc        gc         a Gc       g  a      c  a Tg       t  a       at At       a  a       gt c  a      c  |       cg a  |       tg        gc at        gc        cg cg        cg        gc ta        gc        at                         attttttaagtttgcccccgtttgggcactacctgcggctgcaacaattttacaaccggtgggcgttgaaacgcgttgccgtagacaaaaaggcactgctccatccataaaaagtcatggaattaccgcttgaacatgctctataccccttttcaaacaatgatgggtttcaactccagcgatccaaaggcggaacgatcaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0345 Pyrroline-5-carboxylate reductase ... can be seen here     ..................................................................................................................