                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:182 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-20.10 kcal/mol

                                                                        Nomenclature/Definitions

AACGGCGAAACCTTCTACCAGCGTTTCAATCCCTATAAGGGCGAAACGAAAAAAGCAG
CCTGAccggcggctccatcaacccatcaagcgcggcgtatctcacgccgcgctttttttgttgctcatcataaataagaaaattttccctgacaatt
tacctatcttgcgtaaatcgctggttttcagtagtttgctacagagtatgggatggaggcctaggtttaaaatcctcttgcagcctgcctcctgaaagtg
gaaacggtttcgagacacaggcgtcttaacttggcggatcgtactATG

    BRA0792 --- BRA0791 Gene: BRA0792     GI: 23500526     BI number: BRA0792     GOG: COG2932     Description: peptidase, S24 family Gene: BRA0791     GI: 23500525     BI number: BRA0791     GOG: COG1525     Description: conserved hypothetical protei            c          t  t          a  c           ta           gc           cg           gc           gc           cg           gc           cg           gc           at           at             tttttgttgctcatcataaataagaaaattttccctgacaatttacctatcttgcgtaaatcgctggttttcagtagtttgctacagagtatgggatggaggcctaggtttaaaatcctcttgcagcctgcctcctgaaagtggaaacggtttcgagacacaggcgtcttaacttggcggatcgtactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2932 Predicted transcriptional regulator ... can be seen here [L] COG1525 Micrococcal nuclease (thermonuclease) homologs ... can be seen here     ..................................................................................................................