                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.79 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -7.96 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGTGAttgcaatgccgtaataattcgttctgccaacattcttacaaacgtggtaaagaaccggttaatattggctgacaggcgcgttttttag
ggcttgccagccgttttctgtctataatggtgaggatgatttcatatccctgcaatgccggtgattatcggttctgaagaatggtatatgaaatgaatgc
tgggcagcgcggtgggcgtttccgggggcggaaacaggatcgagtatgcgcgggcagacaaatgcaccgaggatgacaattgccgattttctggtcggtg
atggaATG

    BRA0820 Gene: BRA0820     GI: 23500550     BI number: BRA0820     GOG: COG0789     Description: transcriptional regulator, MerR famil   t t  a c  c t  a t  a a  a c  c a  g at cg cg gt |  a       aa |  a      t  t ta        ta        tt cg        gt       t  t ta        gt       t  t ta        cg       g  a gc        cg       c  g c  |      a  c      g  g t  |      a  t       cg t  |      g  g       gc a  |      a  a       gt a  |      a  c       at t  |      a  a       cg a  |      t  g      a  c a  |      g  g       gc t  |       gc        ta gc        tg        cg cg        gc        gc cg        cg        gc gt        at        tg                         ttttctgtctataatggtgaggatgatttcatatccctgcaatgccggtgattatcggttctgaagaatggtatatgaaatgaatgctgggcagcgcggtgggcgtttccgggggcggaaacaggatcgagtatgcgcgggcagacaaatgcaccgaggatgacaattgccgattttctggtcggtgatggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0789 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_II                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:206 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-14.50 kcal/mol Antiterminator: Size=35 nt.     Delta G= -5.06 kcal/mol Anti-antiterminator:   Size=26 nt.     Delta G= -3.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTCGTGAttgcaatgccgtaataattcgttctgccaacattcttacaaacgtggtaaagaaccggttaatattggctgacaggcgcgttttttag ggcttgccagccgttttctgtctataatggtgaggatgatttcatatccctgcaatgccggtgattatcggttctgaagaatggtatatgaaatgaatgc tgggcagcgcggtgggcgtttccgggggcggaaacaggatcgagtatgcgcgggcagacaaatgcaccgaggatgacaattgccgattttctggtcggtg atggaATG     BRA0820 Gene: BRA0820     GI: 23500550     BI number: BRA0820     GOG: COG0789     Description: transcriptional regulator, MerR famil             t           t  a       tt           c  c      g  a           t  a      g  a           t  a      c  t aA       a  a      c  a g  T      c  c      a  t g  G      a  g       at tg        at        gg at        cg        ag gt        cg        ac t  |       gt        at gc       |  a      t  g gt       |  a       ga cg        ta        gc t  |       cg        ta gc        ta        gg gc        ta        cg ta        gc        ac                         gcgttttttagggcttgccagccgttttctgtctataatggtgaggatgatttcatatccctgcaatgccggtgattatcggttctgaagaatggtatatgaaatgaatgctgggcagcgcggtgggcgtttccgggggcggaaacaggatcgagtatgcgcgggcagacaaatgcaccgaggatgacaattgccgattttctggtcggtgatggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0789 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................