                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -6.80 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-15.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTCTCAAGATCGCCTACCGTTGCAGAACGTGCGCGCATatgaacctcccggattctgtcatgactggccc
ttgtcagaggttagcgtcgatgacgacgaagtccagtcagagttaattgtcacctcattattgtgatgccaaaggcgtgaataggagaaaagggagcgga
ttttttggcccttggtcagcgccacatttagctgattcaacacggcctgaaacagcatgttttaaaggcattgtgctgtagttgtagcgcaacaaagttg
atagttgcgacacggaaatttaagggataGTG

    BRA0848 Gene: BRA0848     GI: 23500577     BI number: BRA0848     GOG: -------     Description: hypothetical protei tt t  t at gt g  g cg gc a  | gc gc gt at a  g a  g at        ca gc       a  t a  a      c  t       cg g  |      c  t      a  g g  |      g  a      c  c a  |       cg       a  c t  |       gc        at a  |       at        cg a  |       cg        ta g  |       ta        ta tg       |  t      a  a gc        gt        gc cg        gc        ta gc        ta        cg gc        ta        gc                         atgttttaaaggcattgtgctgtagttgtagcgcaacaaagttgatagttgcgacacggaaatttaagggataGTG     ..................................................................................................................