                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-15.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-21.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTGGAAATGACGGGCGCTATGCCCATCGCCGCAAAAGACGACCTGTCGCGCCTTGTG
AGCGACCTTACGCGCGGCAAGACGATTATCACGTTCGACGAATAGagacatgctttaaagtttaacg
atcatccgctgcctgatcctgccttccggggaaaggtgaggcccggcggaagccgggtcttttggtttcaagggggtgagtcgcggccctgtggcgcctt
ttttccggccttggccctgtaaaacaggggtctcaaaaaaataatcacactcaagatcacatttaaatcgttataATG

    BRA0873 --- fbp --- fbaA Gene: BRA0873     GI: 23500601     BI number: BRA0873     GOG: -------     Description: hypothetical protein Gene: fbp     GI: 23500600     BI number: BRA0872     GOG: COG0158     Description: fructose-1-6-bisphosphatase Gene: fbaA     GI: 23500599     BI number: BRA0871     GOG: COG0191     Description: fructose-bisphosphate aldolase, class I cc t  g tg cg cg g  a t  a c  a cg tg at g  g ta cg cg gc |  c       ga |  c      g  a tg        cg cg        gc gc        gc cg        cg cg        cg ta        cg             tcttttggtttcaagggggtgagtcgcggccctgtggcgccttttttccggccttggccctgtaaaacaggggtctcaaaaaaataatcacactcaagatcacatttaaatcgttataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0158 Fructose-1,6-bisphosphatase ... can be seen here [G] COG0191 Fructose/tagatose bisphosphate aldolase ... can be seen here     ..................................................................................................................