                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.01 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATAGCCGTGACAACGATCTGGAAGTGAATGTGCTCAAGGGCAAGAAGCTCACCAATAT
CCGCGCCGCCGGCAAGGATGAAGCCGTGAAGCTTACCCCGCCGATCAAGATGACGCTG
GAACGCGCCCTGTCGTGGATTCAGGATGACGAACTGGTGGAAGTGACGCCGAAGTCGA
TCCGTCTTCGCAAGCTTTATCTCGATCCCAATGAGCACAAGCGTTTTCAGAAGAGCAA
GTCGTCGAGTGCTGCATAAcaagcccgacagcatataagaaaacggcgctttcgggcgccgtttttgtTTG

    BRA0874 Gene: BRA0874     GI: 23500602     BI number: BRA0874     GOG: COG1739     Description: conserved hypothetical protein TIGR0025 GA A  A       ga CG       c  c TA       c  a TG        cg |  C       gc |  A      |  a |  A      |  t T  G      |  a T  T      a  t GC       a  a CG       c  a GT       A  g |  C      A  a       tc A  G      T  a      t  g A  A      A  a       tg CG       C  a       cg AT        Gc        gc CG        Tg        cg GC        Cg        gc AT        Gc        gc |  G       Tg        cg GC        Gc        at TA        At        at AT        Gt        at                         ttgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1739 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................