                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:204 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCCTCGTGATCTATTTCAGCGTTGCGCTGGTCATCCTGTCGGGCACGCTTTTATAA
ggcccgggcatgtcacgaagcagtggaaaccggttttttgatcacgacatgcccagaaaaattcaaaaaactgacagattaggcgtgtaaaagccgattg
aaattcaggttttatggcctaaataagaggcagtttcgcgctgcctctttctaaaacgcaaaaaaacctgtaagagcgccgcattgtttttccgcgcggg
tttattggcgcggctcccaactcatatagaagtgatctccatATG

    BRA0875 Gene: BRA0875     GI: 23500603     BI number: BRA0875     GOG: COG1217     Description: GTP-binding protein Typ            TA CA       T  T T  T       TA GC        TA GC        Cg T  |      G  | G  |      C  | T  |      A  | AT        Cg tG        Gc aT        Gc        ag c  C       Gc       a  c cG        Cg       g  a tG       T  |       cg cG       G  |       at t  C      T  |       cg a  A       Cg        tg gC        Cg       g  a tG       |  c      t  a gC        Ta       a  a aT        At       c  | aT        Cg       g  | gT       T  |       gc aT        Gt        gc tA        Gc        cg aT        Ta        cg                         ttttttgatcacgacatgcccagaaaaattcaaaaaactgacagattaggcgtgtaaaagccgattgaaattcaggttttatggcctaaataagaggcagtttcgcgctgcctctttctaaaacgcaaaaaaacctgtaagagcgccgcattgtttttccgcgcgggtttattggcgcggctcccaactcatatagaagtgatctccatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG1217 Predicted membrane GTPase involved in stress response ... can be seen here     ..................................................................................................................