                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=2 nt.   Size=17 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=56 nt.     Delta G=-20.40 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

taatgattttcgtgatagcgctggcttcgaggccgaatgtgcgcagggcgcggccatgggttttgacggcaagacgctgatccatccgggccagatcgaa
gcggccaatcgcgccttctcaccgacggaggaggaagtggcccatgcgcgcgcagtgcgcgagatttttgcctggccggaaaatgccggcaagggcgtcg
tttcgctggacgggcaaatggtcgagcgcctgcatctggaaatggccgaacggattctcgcgaaggctggtataaatctgtaacgaaggaagcaagagca
ATG

    BRA0880 --- BRA0879 Gene: BRA0880     GI: 23500608     BI number: BRA0880     GOG: COG5515     Description: conserved hypothetical protein Gene: BRA0879     GI: 23500607     BI number: BRA0879     GOG: COG0346     Description: glyoxalase family protei cg t  a a  a        g g  g      c  a a  c      c  c cg       a  g cg        cg gc        ta gc        cg g  a       tg c  |       ta c  |       cg t  |       cg a  |      g  a c  |      c  a c  |      g  g ta       c  | at       t  | gc       a  | t  |       at cg        cg gc        cg cg        gc |  c       gc |  c      |  c |  t      |  a        c at       |  t      g  a gc        cg        cg at        gc        gt a  c      |  g       cg c  a      a  c       gc gc       a  g       cg gc        gc        gc cg        cg        tg                         agatttttgcctggccggaaaatgccggcaagggcgtcgtttcgctggacgggcaaatggtcgagcgcctgcatctggaaatggccgaacggattctcgcgaaggctggtataaatctgtaacgaaggaagcaagagcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5515 Uncharacterized conserved small protein ... can be seen here [E] COG0346 Lactoylglutathione lyase and related lyases ... can be seen here     ..................................................................................................................