                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.00 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTTATCTGATCGAACAGGAATTGCGGAGTGGCGAACTGGTGCTGCTTTTTGAAAAAC
CAATGCGAACCGAGAATGAATACTATCTCGTTGTGCCGGAGGGAAAACTGGAAAATCC
GCTGACGCAGGTGTTCTGCCAGTGGATCGCCGGGCAGGTCGGGAATACCGACTACTCG
TCGTTGGTTCATTCCAAACCGGAATGAattgttgcgcaaataacgctgtccaaccggctttcgcggcgtgaaatagaagc
agtcgggcagggtgcccgtgtttcactattttaatggttgatctcaATG

    BRA0905 Gene: BRA0905     GI: 23500632     BI number: BRA0905     GOG: COG0665     Description: oxidoreductase, putativ             g           g  c            cg         g            gt       g  g ca        cg       a  t c  a       ta        cg t  c      |  a       gc gc       |  a       gc tg       |  t       gc cg       |  a       cg gc       |  g      t  | c  |       ta       g  | a  |       ta       a  | a  |       cg       c  | t  |       gc       g  | at       g  a      a  | at       c  |      a  | at        cg       g  | c  |       at        at gc       a  c       tg cg        cg        at gc        cg        at tg        tg        at tg        gc        gc gc        ta        ta tg        cg        gc                         tattttaatggttgatctcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here     ..................................................................................................................