                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCGAACTGATATTCTCGCTCGATCCCTGTGCCCTATCGACAGTGCTGAGCGTCGAA
TTGGTACTTTGGCACCCGGCGACGGTCAAAGCCAGAAGTGCGGCGGCGATGATAAGGC
CGTTTCGGCCTGCTCCACCCGACGCCTCAATTCCCGAAACCTCCGTTTCAGACAATTG
CATCACCTTTAAGCGCATCGCCAATTGCAGCATtcctttcagctcgacagaaacagcaaggccacgggcccctgct
tcttttccattccgcaccggatcttcagaccttacgcctcgccggacgatTTG

    BRA0965 Gene: BRA0965     GI: 23500691     BI number: BRA0965     GOG: -------     Description: hypothetical protei             c           g  t           a  c            cg            ta           t  c           t  a           c  |            cg            ta            Ta           A  a           C  c        c           G  a      a  g CC       A  |       cg G  A       Cg        cg C  A       Gc        gc T  T       Ta        gc AT        Ta       |  c CG       A  |      a  c GC       A  |       at |  A       Cg        cg CG        Cg        gc GC        Gc        at                         tcttttccattccgcaccggatcttcagaccttacgcctcgccggacgatTTG     ..................................................................................................................