Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:205 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-16.40 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-11.31 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGGTTATCGCGCATTTGGAAACTGAAAATATTGCGATTGAAGACGGGCCTGTGGCG
CGCACAGGTGCGATGGGGCCAATCCGCTCCATCTATTTTCGTGATCCCGACGGAAACC
TCGTGGAAATTTCAGAATATATCGACCTGTAGctgccgaacggggtggcaaacgggatatttcccgtgcgctgtca
ttatttttcatagtctgccagccaatctttgcatcagcgcaacgattggtttgggggattatgcgaagcacagccagataaaacggggcggggattgaac
taagcatcATG

    BRA1000


Gene: BRA1000     GI: 23500724     BI number: BRA1000     GOG: -------     Description: conserved hypothetical protei


  C
G  G
T  A
T  T
A  T
T  G
A  A
A  A
A  G
A  A
 GC
 TG        AC
 CG       C  A
A  G      G  G
A  |       CG
A  |       GT
 GC        CG        AT
 GC        GC       A  C
T  T      G  G      C  C
T  G       TA        CG
T  T       GT        GC
A  G       TG        GT
 CG        CG        GC
 GC        CG        GC
 CG       G  G       TA
 GC        GC        AT
 CG        GC        GC
                        TATTTTCGTGATCCCGACGGAAACCTCGTGGAAATTTCAGAATATATCGACCTGTAGctgccgaacggggtggcaaacgggatatttcccgtgcgctgtcattatttttcatagtctgccagccaatctttgcatcagcgcaacgattggtttgggggattatgcgaagcacagccagataaaacggggcggggattgaactaagcatcATG
    ..................................................................................................................