                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:8 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCACCATGTTCCTGCAAATGCGCATGAACCCGACGCCGCCCGATCCGACACAGGCT
GCGATCTTCACCTGGATGCCCATCATCTTCACCTTCATGCTGGCTTCGTTCCCGGCTG
GTCTGGTGATCTACTGGGCATGGAACAACACGCTCTCGATCATCCAGCAGAGTGTCAT
CATGAAACGTCAGGGCGTGAAGATCGAACTCTTCGACAACCTCAAGGGGCTTTTCAGG
CGAAAACCGAAAGAGGCGAATAAATAActccagaaaaaccccgctttggcggggttttttgtgccgacATG

    BRA1024 Gene: BRA1024     GI: 23500747     BI number: BRA1024     GOG: COG0218     Description: GTP-binding protein, putativ            TA           A  A           A  A           G  T           C  A           G  A GG        Gc A  C       At CG        Gc TA       |  c TA       A  a TA       A  g TA       A  a C  |      G  a GC       C  a       tt GC       C  a      t  g G  G      A  a       cg G  A      A  c       gc A  A      A  c       cg A  A      A  c       cg CG        Gc        cg TA        Cg        cg CG        Gc        at CG        Gt        at                         ttttgtgccgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0218 Predicted GTPase ... can be seen here     ..................................................................................................................