                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:118 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-22.70 kcal/mol
Antiterminator:    Distance from promoter:69 nt. Size=61 nt.     Delta G=-13.61 kcal/mol
Anti-antiterminator:    Distance from promoter:43 nt.    Size=48 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcct-tacaaa. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcctctaatacaaaatctggtacaaatcccgacaatgcgaagtgctaaactattgattttacgtgcatagaagacaggaaacgtcattcttcttccgg
gcaccatttccaagtcttccgaccactaccaaggttcagaagcaccccaaaaagcccgcgcaagcgggctttcttggttttttgcgatggcgtgggcggg
cgcgtctgtgttcaaccttcccaagaccggattggcattcgATG

   ن Gene: BRA1054     GI: 23500776     BI number: BRA1054     GOG: COG0778     Description: nitroreductase family protei            ac           t  c           c  a           a  a            cg            cg            at tc        gt t  t      |  c c  t      c  a t  c       cg t  c       ta a  g       ta cg        cg tg       |  c gc        ta |  a       gc |  c      a  c       ca |  c      a  c      g  a c  a      c  c       cg at       c  a       gc at       t  a       cg at       t  a       cg gc       t  a       cg gc       a  a       gc |  a      c  |       at a  a      c  |       at cg       a  |       at at        cg       |  c gc        gc        at at        gc        at at        gc        cg gc        cg        cg                         ttttttgcgatggcgtgggcgggcgcgtctgtgttcaaccttcccaagaccggattggcattcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0778 Nitroreductase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_II                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:125 nt.    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-15.40 kcal/mol Antiterminator:    Distance from promoter:85 nt. Size=61 nt.     Delta G=-13.61 kcal/mol Anti-antiterminator:    Distance from promoter:65 nt.    Size=49 nt.     Delta G= -7.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgcct-tacaaa. It has a score value of 64.26 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgcctctaatacaaaatctggtacaaatcccgacaatgcgaagtgctaaactattgattttacgtgcatagaagacaggaaacgtcattcttcttccgg gcaccatttccaagtcttccgaccactaccaaggttcagaagcaccccaaaaagcccgcgcaagcgggctttcttggttttttgcgatggcgtgggcggg cgcgtctgtgttcaaccttcccaagaccggattggcattcgATG    ن Gene: BRA1054     GI: 23500776     BI number: BRA1054     GOG: COG0778     Description: nitroreductase family protei            ac           c  c           g  c           a  c            aa            ga            aa            ca tc       |  a t  c      t  g cg        tc ta        gc gc        gc a  c       ag a  a      |  c c  c       ag c  t       cc t  a      c  a t  c      a  a t  c      t a  a      c c  a      a c  g      c a  |      c cg       a gt       g  |       ca gt       c  |      g  a gc       c  |       cg c  a       t        gc cg        t        cg ta        c        cg ta        t        cg cg        g        gc                         tttcttggttttttgcgatggcgtgggcgggcgcgtctgtgttcaaccttcccaagaccggattggcattcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0778 Nitroreductase ... can be seen here     ..................................................................................................................