                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGGGAGAAAAATGCGGCACAAAGGCCTGCTGGAATTTGGGCGAAACAGAACGTTTT
ATGGGCTGTTTCTCTTCTGTGCGGTTTGCGCCATTGCGGGCAGCCTGCTCAGCCATGA
TGGCGAAATATCCCTCTGGCGCTGGCTGCATtatctcaccaagccgaccgcaacccttcttttgctgggcgctgtgc
tttgcgcaaagcggacgaattcaaagccatatggccttgctatcgctttcgggctggccttcgccgcgcttggagactttttcctgatgctgccaggcga
ttatttcATG

    BRA1057 --- BRA1058 Gene: BRA1057     GI: 23500779     BI number: BRA1057     GOG: COG3714     Description: hypothetical protein Gene: BRA1058     GI: 23500780     BI number: BRA1058     GOG: COG1012     Description: aldehyde dehydrogenase family protei            at           t  c            cg            gc           |  t           |  t       tt           |  t      c  c           t  c       cg            tg        gc            cg        gc            cg        tg ta        gc       |  c a  t      g  |       cg cg       t  |       gc cg       a  |       gt gc       t  |       gt a  c       at        cg at        cg        tg at        cg        ta cg        gc        tg                         actttttcctgatgctgccaggcgattatttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3714 Predicted membrane protein ... can be seen here [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................