Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=61 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G=-11.12 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAGAGATTGCCGAAGGCGATGCCCCCGAGAATAAGAAGCGCCACTCCGAGCGCGACA
AACCATCCCCACTTGCTGGAAAGTTCATGAGGAAGGCTGGGGCGGTCAAAATTATTAT
GTGCTGTTGTCATagaatgaatgtccctcaaaatttcatcaatgcgaagcaatataaggcacaactgaaaaataaccagttgttgcacagg
cttgaacaggcaggattttcgcactgttcgttttgtgggcaaagcattatatctctttgccgttaaagccattttttgcttaaagtttgctggATG

    cls


Gene: cls     GI: 23500782     BI number: BRA1060     GOG: COG1502     Description: cardiolipin synthas


  t
c  c
c  a
c  a
t  a
g  a        a
t  t      a  t
 at       a  a
 at       a  a
 gc       a  c
 ta        gc
a  |       ta
 at        cg
 gc        at
a  a       at
 Ta        cg
 At       |  t
 Cg        at
|  c       cg
|  g       gc
|  a      g  a
|  a      a  c
 Tg       a  a        t
 Gc       t  g      a  t
 Ta       a  g      g  t
 Ta       t  c      g  t
 Gt        at       a  c
|  a       at        cg
|  t       cg        gc
|  a      |  a      |  a
|  a      g  a       gc
 Tg       a  c       at
 Cg       a  a       cg
 Gc       g  g       at
 Ta        cg        at
 Gc        gc        gc
 Ta        ta        tg
                        ttttgtgggcaaagcattatatctctttgccgttaaagccattttttgcttaaagtttgctggATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[I] COG1502 Phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthases and related enzymes ... can be seen here

    ..................................................................................................................