                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -8.02 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-19.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCACCTTGCTGCTGGGGCTTATCATTGCCATTCAATGGCCGGTCAACAGCCTGTTCAT
CCTGGGCCTTTTCCTCGCGATAGACCTTATCTTCCAGGGCTGGTCTTTCATCGCCTTC
GGCCTTGGCATCAAGAGCCGGTAAaacaccgcccaTCACAGGCGAAAGCGGCGCATCATGCG
CCGCTTTTTCATTTCAAACACCGACTTGTTGAGATTCCGCCCAATGACTGCTAGATGC
TGCGCAACATCTTCGCAGTGCGCTTTCACgcgcggcccaacatttcgccatcacgagttttttcATG

    prfC Gene: prfC     GI: 23500785     BI number: BRA1063     GOG: COG4108     Description: peptide chain release factor CA G  T GC TA TA CG |  A CG GC GC C  | T  |        C T  |      T  A CG       a  C CG       c  A GT        cG C  A       cG T  |       gC A  |       cG C  |      c  A TA       a  A Ta       c  A Ta       a  G        C C  c      a  |      T  A Ta       A  |      A  T Gc       A  |       CG Gc       T  |       GC T  |      G  |       CG Cg        GC        GC Gc        CG        GC Gc        CG        CG Gc        GC        GC                         TTTTTCATTTCAAACACCGACTTGTTGAGATTCCGCCCAATGACTGCTAGATGCTGCGCAACATCTTCGCAGTGCGCTTTCACgcgcggcccaacatttcgccatcacgagttttttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG4108 Peptide chain release factor RF-3 ... can be seen here     ..................................................................................................................