                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:199 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCAGTTCCTGATTGCCCAGCGACAGATCGTGCGGTGTGAAGCTGCGCAATATCTCCA
ACCCGCGCACGAGCGCGCTCGAAACCTGCGCGGAATCTTTTTCCAGGTCCTGCGTCGT
CGGTTTCATtctctttttcacggtttctcctgacgttctcagtgcgagtgctaaaggcagaaaaagggggaggtgacaaaagtgaaatttaatt
ccatttatattgacgacttcgattttggttgtcaatactatgtgcaagccgccgcagaacggtaacgaaatatccagacgggaagcaggcATG

    BRA1081 --- BRA1080 --- BRA1079 --- BRA1078 --- BRA1077 --- BRA1076 Gene: BRA1081     GI: 23500803     BI number: BRA1081     GOG: COG0601     Description: peptide ABC transporter, permease protein Gene: BRA1080     GI: 23500802     BI number: BRA1080     GOG: COG1173     Description: peptide ABC transporter, permease protein Gene: BRA1079     GI: 23500801     BI number: BRA1079     GOG: COG0444     Description: peptide ABC transporter, ATP-binding protein Gene: BRA1078     GI: 23500800     BI number: BRA1078     GOG: COG4608     Description: peptide ABC transporter, ATP-binding protein Gene: BRA1077     GI: 23500799     BI number: BRA1077     GOG: COG1804     Description: CAIB/BAIF family protein Gene: BRA1076     GI: 23500798     BI number: BRA1076     GOG: COG1012     Description: aldehyde dehydrogenase family protei            GC           C  G            GC            AT            GC            CG           |  A           |  A           |  A           |  C           |  C CG        AT A  A       CG CG        GC GC        CG CG        GC GC        CG CG        CG             AATCTTTTTCCAGGTCCTGCGTCGTCGGTTTCATtctctttttcacggtttctcctgacgttctcagtgcgagtgctaaaggcagaaaaagggggaggtgacaaaagtgaaatttaattccatttatattgacgacttcgattttggttgtcaatactatgtgcaagccgccgcagaacggtaacgaaatatccagacgggaagcaggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here [C] COG1804 Predicted acyl-CoA transferases/carnitine dehydratase ... can be seen here [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................