                                                                        Gene putatively regulated by attenuation in B_suis_1330_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAAACCCCGGCATTCCTCAGTTCAATCAATATGTCTCGCGCCGCCCCGGCGGGGTGAG
AGGATTTCTTATCCATatattccgggctttctctgcctgcatagactcttggatgaaagaatcatccgctgattcggaatttttccca
gcgtctttttcggttgcccggatgctggtgagaatttttccgaaatggggttgtctcatcttatgacagacgttatagcataacgcaattggcgtaataa
aataacatatcatgcaaatatgatgttcctccccgattgctcaagagagataccATG

    znuA Gene: znuA     GI: 23500837     BI number: BRA1122     GOG: COG4531     Description: zinc ABC transporter, periplasmic zinc-binding protei             t           t  t            at            at            gc        tg            gc       t  c           c  |       gc           t  |       gc           t  |       cg   g       a  |      t  | a  a       gc       t  | a  a       ta       t  | at        cg       t  | gc        gc       t  | ta        cg        cg at       c  |       ta gc       t  |       gt gc       a  |       cg tg       c  |       gc |  c      t  |       at t  t      a  |       cg cg        at        cg ta        gc       |  t c  t       at        cg at        at        ta gc        at        tg                         aatttttccgaaatggggttgtctcatcttatgacagacgttatagcataacgcaattggcgtaataaaataacatatcatgcaaatatgatgttcctccccgattgctcaagagagataccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG4531 ABC-type Zn2+ transport system, periplasmic component/surface adhesin ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_suis_1330_II                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -6.80 kcal/mol Antiterminator: Size=32 nt.     Delta G= -8.40 kcal/mol Anti-antiterminator:   Size=56 nt.     Delta G=-13.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TAAACCCCGGCATTCCTCAGTTCAATCAATATGTCTCGCGCCGCCCCGGCGGGGTGAG AGGATTTCTTATCCATatattccgggctttctctgcctgcatagactcttggatgaaagaatcatccgctgattcggaatttttccca gcgtctttttcggttgcccggatgctggtgagaatttttccgaaatggggttgtctcatcttatgacagacgttatagcataacgcaattggcgtaataa aataacatatcatgcaaatatgatgttcctccccgattgctcaagagagataccATG     znuA Gene: znuA     GI: 23500837     BI number: BRA1122     GOG: COG4531     Description: zinc ABC transporter, periplasmic zinc-binding protei   c t  t t  c t  t cg gc gc gt cg c  c t  | ta at ta |  g        g |  a      a  a |  c      a  a        t |  t       at       t  t a  c       gc        at T  t       ta        at At        at        gc Cg        gc        gc Cg        gc       c  | Ta        tg       t  | At       |  c      t  | Tg       t  t      a  | Ta        cg        gc C  a       ta        ta Ta       c  t       cg Tg        at        gc Ta        gc        cg                         tctttttcggttgcccggatgctggtgagaatttttccgaaatggggttgtctcatcttatgacagacgttatagcataacgcaattggcgtaataaaataacatatcatgcaaatatgatgttcctccccgattgctcaagagagataccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG4531 ABC-type Zn2+ transport system, periplasmic component/surface adhesin ... can be seen here     ..................................................................................................................